View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1534_low_3 (Length: 252)
Name: NF1534_low_3
Description: NF1534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1534_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 21 - 241
Target Start/End: Original strand, 395796 - 396015
Alignment:
| Q |
21 |
gtagggttttgagagattcgagtgtcatggttatatggttttagggggaagtggaaatggaaatgaataagaataagaaaatagagtttgaacattataa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
395796 |
gtagggttttgagagattcgagtgtcatggttatatggttttagggggaagtggaaatggaaatgaataagaataagaaaatagagtttgaacattataa |
395895 |
T |
|
| Q |
121 |
gctatatacnnnnnnnngtaaacagttatgaagaacttacgagaataagataaaaacaatgttcggcctatggtattggcttggcatatgggagtgtgtt |
220 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
395896 |
gctatatac-tttttttgtaaacagttatgaagaacttaccagaataagataaaaacaatgtttggcctatggtattggcttggcatatgggagtgtgtt |
395994 |
T |
|
| Q |
221 |
cctcctcaattcgattctctc |
241 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
395995 |
cctcctcaattcgattctctc |
396015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 191 - 228
Target Start/End: Complemental strand, 30483939 - 30483902
Alignment:
| Q |
191 |
tggtattggcttggcatatgggagtgtgttcctcctca |
228 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
30483939 |
tggtattggcttgggatatgggagtgtgctcctcctca |
30483902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Original strand, 36720402 - 36720438
Alignment:
| Q |
191 |
tggtattggcttggcatatgggagtgtgttcctcctc |
227 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
36720402 |
tggtattggcttgggatatgggagtgtgctcctcctc |
36720438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 230
Target Start/End: Complemental strand, 23140968 - 23140928
Alignment:
| Q |
190 |
atggtattggcttggcatatgggagtgtgttcctcctcaat |
230 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
23140968 |
atggtattggcttgggacatgggtgtgtgttcctcctcaat |
23140928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 230
Target Start/End: Complemental strand, 23552758 - 23552718
Alignment:
| Q |
190 |
atggtattggcttggcatatgggagtgtgttcctcctcaat |
230 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
23552758 |
atggtattggcttgggacatgggtgtgtgttcctcctcaat |
23552718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University