View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15350_high_3 (Length: 251)
Name: NF15350_high_3
Description: NF15350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15350_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 33318867 - 33319007
Alignment:
| Q |
1 |
ttgtaatttaattatatcttcctcctttaatgttgaacatcatagtgatatattagctattgagatggcttttaaaagaggatggacatctatttggttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33318867 |
ttgtaatttaattatatcttcctcctttaatgttgaa--tcatagtgatatattagctattgagatggcttttaaaagaggatggacatctatttg---g |
33318961 |
T |
|
| Q |
101 |
ttggaaacatactattttttcttcaccttagttttattccattagg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33318962 |
ttggaaacatactattttttcttcaccttaattttattccattagg |
33319007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 33319074 - 33319106
Alignment:
| Q |
209 |
gaggcaacatgtctttcatcattgttacctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
33319074 |
gaggcaacatgtctttcatcattgttatctttg |
33319106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University