View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15350_low_1 (Length: 701)
Name: NF15350_low_1
Description: NF15350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15350_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 2e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 170 - 362
Target Start/End: Complemental strand, 20895250 - 20895070
Alignment:
| Q |
170 |
ggagtttcttacgaaatttcctgagctactaggaaaaggaaatattgagtgagccacttgtattgtattgtattaagtaagtgccgtttgcttgctgtga |
269 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20895250 |
ggagtttcttacgaaatttcctgagctaattggaaaaggaaatattgagtgagccacttgtattgtattgtattaagt----gccgtttgcttgctgtga |
20895155 |
T |
|
| Q |
270 |
agctttctttcgttgaataataacaaaagagaaagaaactcttgggtttaagggtgagttactgagttatattattgactgggttttttatac |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20895154 |
agctttctttcgttgaataataacaaaagagaaagaaactcttgggtttaagggtga--------gttatattattgactgggttttttatac |
20895070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 7 - 94
Target Start/End: Complemental strand, 20895413 - 20895326
Alignment:
| Q |
7 |
gtgagatgaaaacgcgttcaaaataaaataattcctttctgaaaaaacaccgactttaagattatgattctggctccaatagataggc |
94 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20895413 |
gtgaaatgaaaacgcgttcaaaataaaataattcctttctgaaaaaacaccgactttaagattatgattctggctccgatagataggc |
20895326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 644 - 680
Target Start/End: Original strand, 43017681 - 43017717
Alignment:
| Q |
644 |
tttttgatagccttgatttttattaatttttgaaata |
680 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
43017681 |
ttttggatagccttgatttttattaacttttgaaata |
43017717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University