View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15351_high_31 (Length: 261)
Name: NF15351_high_31
Description: NF15351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15351_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 6697848 - 6698079
Alignment:
| Q |
10 |
cataggacttgggtggggtctgtcccaaacttggtaaacttgtctttattgaatgactctgttcctgttttcattacctttacttcaatcgtgcataaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6697848 |
cataggacttgggtggggtctgtcccaaacttggtaaacttgtctttattgaatgactctgttcctgttttcattacctttacttcaatcgtgcataaac |
6697947 |
T |
 |
| Q |
110 |
atttaaacacccatttgtcaccccaaaacagttaaggataccccaaacacaccattggatttgaaaatcattgtgcaagcttttgattgtaaccaactcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6697948 |
atttaaacacccatttgtcaccccaaaacagttaaggataccccaaacacaccattggatttgaaaatcattgtgcaagcttttgattgtaaccaactcc |
6698047 |
T |
 |
| Q |
210 |
atgcnnnnnnnttaatttgttgatttccacac |
241 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
6698048 |
atgcaaaaaaattaatttgttgatttccacac |
6698079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University