View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15351_high_37 (Length: 218)
Name: NF15351_high_37
Description: NF15351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15351_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 8234927 - 8235126
Alignment:
| Q |
1 |
taaacatatatggagtacttttatttaaagataaacatggatgcatgcatggtaagtactactgctttaatgcagtaaatactaagtgcttaatcgtctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8234927 |
taaacatatatggagtacttttatttaaagataaacatggatgcatgcatggtaagtactactgctttaatgcagtaaatactaagtgcttaatcgtctg |
8235026 |
T |
|
| Q |
101 |
aatttgacaaatcagtagaagggtcgttttctttctttggggttggaaatatttgatttgcaaaaggatgtgatggaggttgattgggaagatgtcttcc |
200 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8235027 |
aatttggcaaatcagtagaatggtcgctttctttctttggggtcggaaatatttgatttgcaaaaggatgtgatggaggttgattgggaagatgtcttcc |
8235126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 149
Target Start/End: Original strand, 8233001 - 8233081
Alignment:
| Q |
69 |
aatgcagtaaatactaagtgcttaatcgtctgaatttgacaaatcagtagaagggtcgttttctttctttggggttggaaa |
149 |
Q |
| |
|
|||| ||||||||||| |||||||||| |||||||||| | ||||||||||| ||| |||| || |||||| ||||||| |
|
|
| T |
8233001 |
aatgtagtaaatactatgtgcttaatcctctgaatttggcgaatcagtagaatggtaatttttttgttttgggattggaaa |
8233081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University