View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15351_high_37 (Length: 218)

Name: NF15351_high_37
Description: NF15351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15351_high_37
NF15351_high_37
[»] chr2 (2 HSPs)
chr2 (1-200)||(8234927-8235126)
chr2 (69-149)||(8233001-8233081)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 8234927 - 8235126
Alignment:
1 taaacatatatggagtacttttatttaaagataaacatggatgcatgcatggtaagtactactgctttaatgcagtaaatactaagtgcttaatcgtctg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8234927 taaacatatatggagtacttttatttaaagataaacatggatgcatgcatggtaagtactactgctttaatgcagtaaatactaagtgcttaatcgtctg 8235026  T
101 aatttgacaaatcagtagaagggtcgttttctttctttggggttggaaatatttgatttgcaaaaggatgtgatggaggttgattgggaagatgtcttcc 200  Q
    |||||| ||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8235027 aatttggcaaatcagtagaatggtcgctttctttctttggggtcggaaatatttgatttgcaaaaggatgtgatggaggttgattgggaagatgtcttcc 8235126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 149
Target Start/End: Original strand, 8233001 - 8233081
Alignment:
69 aatgcagtaaatactaagtgcttaatcgtctgaatttgacaaatcagtagaagggtcgttttctttctttggggttggaaa 149  Q
    |||| ||||||||||| |||||||||| |||||||||| | ||||||||||| |||  |||| ||  |||||| |||||||    
8233001 aatgtagtaaatactatgtgcttaatcctctgaatttggcgaatcagtagaatggtaatttttttgttttgggattggaaa 8233081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University