View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15351_low_17 (Length: 436)
Name: NF15351_low_17
Description: NF15351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15351_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 8e-34; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 216 - 289
Target Start/End: Complemental strand, 40869659 - 40869586
Alignment:
| Q |
216 |
ggatctgaatcgaatatgtgaattaattcaatggaatcgatcaacttaatgttgaattctccagcttcatactt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40869659 |
ggatctgaatcgaatatgtgaattaattcaatggaatcgatcaacttaatgttgaattctccagcttcatactt |
40869586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 344 - 426
Target Start/End: Complemental strand, 40869546 - 40869470
Alignment:
| Q |
344 |
gtgtgatgcgattctcgaattatggatttttctgtatgaattatcatcatgatgaatgattgatgttgttcgtaccaaccgat |
426 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40869546 |
gtgtgatgcgattctcgaattatggatttttctgtatgaattatc------atgaatgattgatgttgttcgtaccaaccgat |
40869470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 103 - 144
Target Start/End: Complemental strand, 40869772 - 40869731
Alignment:
| Q |
103 |
gaaggatgatcaatttcttaattgatttctttttctttatgg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40869772 |
gaaggatgatcaatttcttaattgatttctttttctttatgg |
40869731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 40869857 - 40869825
Alignment:
| Q |
18 |
cttcataattacgtaaattaattaattacacga |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40869857 |
cttcataattacgtaaattaattaattacacga |
40869825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University