View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15351_low_34 (Length: 287)
Name: NF15351_low_34
Description: NF15351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15351_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 65 - 278
Target Start/End: Complemental strand, 26621298 - 26621085
Alignment:
| Q |
65 |
caaactttataacatgtgctgcactaaataggctttgtaataatcaaacgttgaatatcttggtaagagcttgcaatgcattaagttgcaacctcaactg |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26621298 |
caaactttataacatgtgctgcactaaataggctttgtaataatcaaacgttgaatatcttggtaagagcttgcaatgcattaagttgcaacctcaactg |
26621199 |
T |
|
| Q |
165 |
caagatatgctccgcggtccgaagaaaaagccggtccgcctttaacccgtcgcctcctggaattatccgctgcaatttcttcatcttcctccctactgcc |
264 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
26621198 |
caagatatgctccgccgtccgaagaaaaagctggtccgcctttaacccgtcgcctcctggaattatccgttgcaatttcttcatcttccttcctactgct |
26621099 |
T |
|
| Q |
265 |
acctctctgctcct |
278 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
26621098 |
acctctcttctcct |
26621085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University