View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15351_low_39 (Length: 249)
Name: NF15351_low_39
Description: NF15351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15351_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 24 - 124
Target Start/End: Complemental strand, 34977890 - 34977790
Alignment:
| Q |
24 |
gaaggaagatttcaacattcagttacgttcccgcggataaataatgaacgacccctttaatttacggttggatcttaagttttgaagaagtacatgtttc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
34977890 |
gaaggaagatttcaacattcagttacgttcccgcggataaataatgaacgacccctttactttacggttggatcttaagttttgaagaagcacgtgtttc |
34977791 |
T |
|
| Q |
124 |
c |
124 |
Q |
| |
|
| |
|
|
| T |
34977790 |
c |
34977790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 189 - 249
Target Start/End: Complemental strand, 34977725 - 34977665
Alignment:
| Q |
189 |
ctgaaattagatgattctggaactatcatgaaattcataacagctttgaatttcagaactc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34977725 |
ctgaaattagatgattctggaactatcatgaaattcataacagctttgaatttcagaactc |
34977665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University