View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15351_low_39 (Length: 249)

Name: NF15351_low_39
Description: NF15351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15351_low_39
NF15351_low_39
[»] chr8 (2 HSPs)
chr8 (24-124)||(34977790-34977890)
chr8 (189-249)||(34977665-34977725)


Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 24 - 124
Target Start/End: Complemental strand, 34977890 - 34977790
Alignment:
24 gaaggaagatttcaacattcagttacgttcccgcggataaataatgaacgacccctttaatttacggttggatcttaagttttgaagaagtacatgtttc 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||    
34977890 gaaggaagatttcaacattcagttacgttcccgcggataaataatgaacgacccctttactttacggttggatcttaagttttgaagaagcacgtgtttc 34977791  T
124 c 124  Q
    |    
34977790 c 34977790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 189 - 249
Target Start/End: Complemental strand, 34977725 - 34977665
Alignment:
189 ctgaaattagatgattctggaactatcatgaaattcataacagctttgaatttcagaactc 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34977725 ctgaaattagatgattctggaactatcatgaaattcataacagctttgaatttcagaactc 34977665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University