View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15351_low_9 (Length: 513)
Name: NF15351_low_9
Description: NF15351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15351_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 4e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 4e-98
Query Start/End: Original strand, 98 - 298
Target Start/End: Original strand, 17227276 - 17227476
Alignment:
| Q |
98 |
ttatgtgaaatgagtatggagagtaagggaatagtatttattaagagagaaataaataaaagtggttatatgttttttgtaatgttgctaaggtatgata |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17227276 |
ttatgtgaaatgagtatggagagtaagggaatagtatttattaagagagaaataaataaaagtggttatatgttttttgtaatgttgctaaggtatgata |
17227375 |
T |
 |
| Q |
198 |
ataaaattaaatttggagaa-agagtgaagaggagtgggttgaagttgaaatgaagaggacaagtgcatgggagaaagaagtgggctatgggtgttatta |
296 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17227376 |
ataaaattaaatttggcgaagagagtgaagaggagtgggttgaagttg-aatgaagaggacaagtgcatgggagaaagaagtgggctatgggtgttatta |
17227474 |
T |
 |
| Q |
297 |
at |
298 |
Q |
| |
|
|| |
|
|
| T |
17227475 |
at |
17227476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 345 - 500
Target Start/End: Original strand, 17227515 - 17227670
Alignment:
| Q |
345 |
ttaggccatactgtcctttctgaatgtgtcccctaactggggttagtgttcaagtggcttaagaaaattgtgcttgtttatcggcctacgatgtgggacc |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17227515 |
ttaggccatactgtcctttctgaatgtgtcccctaactggggttagtgttcaagtggcttaagaaaattgtgcttgtttatcggcctacgatgtgggacc |
17227614 |
T |
 |
| Q |
445 |
tctttgtgtcagtcacaccacgcaaccccatgttatcttactactactactacttc |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17227615 |
tctttgtgtcagtcacaccacgcaaccccatgttatcttactactactacttcttc |
17227670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University