View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15352_high_12 (Length: 337)
Name: NF15352_high_12
Description: NF15352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15352_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 8e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 21 - 184
Target Start/End: Original strand, 33189913 - 33190076
Alignment:
| Q |
21 |
tagttgcatttgtcattaagaaaaatgaagatgaaataattgtctaattaaaaagtataaatgtaaattaggtctaagaaaaacttcctatcttttaaca |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33189913 |
tagtagcatttgtcattaagaaaaatgaagatgaaataattgtctaattaaaaagtataaatgtaaattaggtcaaagaaaaacttcctatcttttaaca |
33190012 |
T |
|
| Q |
121 |
taacattaacatataatggtgaaaaatattccggggttgctttagaattgtattggttggttaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33190013 |
taacattaacatataatggtgaaaaatattccggggttgctttagaattgtattggttggttaa |
33190076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University