View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15352_high_14 (Length: 293)
Name: NF15352_high_14
Description: NF15352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15352_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 68 - 276
Target Start/End: Complemental strand, 42422694 - 42422480
Alignment:
| Q |
68 |
tggtctaaggctaccaccgtcattggt------attttagactgaattgttgttttgattttagactaaatttcctgattatgttgatgtttacaaannn |
161 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42422694 |
tggtctaaggctaccactgtcattggtgttttgattttagactgaattggtgttttgattttagactaaatttcctgattatgttgatgtttacaaaata |
42422595 |
T |
 |
| Q |
162 |
nnnnnnnnnnnnnnnncaaggagtgtttcgccatcacttttctttataccaagagttctattgagggttctttagaagttgcgccaatgaaaagattgtg |
261 |
Q |
| |
|
||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42422594 |
tatatttatatatatacaaggagtgtttcaccgtcacttttttttataccaagagttctattgagggttctttagaagttgcaccaatgaaaagattgtg |
42422495 |
T |
 |
| Q |
262 |
ccaacttgttggacc |
276 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42422494 |
ccaacttgttggacc |
42422480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 16 - 94
Target Start/End: Complemental strand, 42422772 - 42422694
Alignment:
| Q |
16 |
tgtggtctaagacaggattctttgttgaaggttgaaggcaagccatggtctatggtctaaggctaccaccgtcattggt |
94 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
42422772 |
tgtggtctaaggcaggattctctgttgaaggttgaaggcaagccatggtctatggtctaaggctaccactgccattggt |
42422694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University