View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15352_low_22 (Length: 267)
Name: NF15352_low_22
Description: NF15352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15352_low_22 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 267
Target Start/End: Original strand, 44471056 - 44471312
Alignment:
| Q |
13 |
catcatataatatgtccatgagctatattttcagcttattcgcacaagtttttcatgatatagcctatgaaaataatagattaaaactaatatgaaaaca |
112 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44471056 |
catcttataatatgtccatgacctatattttcagcttattcgcacaagtttttcatgatatagcctatgaaaataatagattaaaactaatatgaaaaca |
44471155 |
T |
|
| Q |
113 |
--tatctttatataatttgcagatttttgcaagtccagatcctaatacggggttgttcaagcagtgtgggacggatatatttgcagtacatgcagattgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44471156 |
catatctttatataatttgcagatttttgcaagtccagatcctaacacggggttgttcaagcagtgtgcgacggatatatttgcagtacatgcagattgt |
44471255 |
T |
|
| Q |
211 |
ataggaaaaatctgcaatatgcactttgttagggttggaacagatggttggatacca |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
44471256 |
ataggaaaaatctgcaatatgcactttgttagtgttggaagagatggttggatacca |
44471312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 196 - 263
Target Start/End: Original strand, 44485515 - 44485582
Alignment:
| Q |
196 |
gtacatgcagattgtataggaaaaatctgcaatatgcactttgttagggttggaacagatggttggat |
263 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||| |||||||||| |||||||| |||||||||| |
|
|
| T |
44485515 |
gtacatggagattgtataggcaaaatctgcaatatgatctttgttaggtttggaacaaatggttggat |
44485582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 196 - 267
Target Start/End: Original strand, 44475306 - 44475377
Alignment:
| Q |
196 |
gtacatgcagattgtataggaaaaatctgcaatatgcactttgttagggttggaacagatggttggatacca |
267 |
Q |
| |
|
||||| ||| |||||||||| |||||||||| |||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
44475306 |
gtacaagcaaattgtataggcaaaatctgcagtatgttcttcgttaggtttggaacagatggttggatacca |
44475377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University