View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15352_low_6 (Length: 408)
Name: NF15352_low_6
Description: NF15352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15352_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 342; Significance: 0; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 18 - 398
Target Start/End: Original strand, 8245731 - 8246118
Alignment:
| Q |
18 |
acttgtagggtatgaagttggagacagaggatgttgtggcactggcacacttgaagttacttatttatgcaaccatttgcaacccacttgtcccaacgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8245731 |
acttgtagggtatgaagttggagacagaggatgttgtggcactggcacactagaagttacttatttatgcaaccatttgcaacccacttgtcccaacgat |
8245830 |
T |
|
| Q |
118 |
ttggattatgtgttttgggacagttttcaccctactgaatctgtttacagaaaacttgttgcccctattctacagaagtacatgcatcagttactgtgaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||| |
|
|
| T |
8245831 |
ttggattatgtgttttgggacagttttcaccctactgaatctgtttacagaaaacttgttgcccctattctacagaagtacatgcatcaattccagtgaa |
8245930 |
T |
|
| Q |
218 |
cgaataattatttaggtgtaaaga-------tattattttgtgcaattttatgtttacaaagctaaataaatttcattgaatcatcttagcacatgaatg |
310 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8245931 |
cgaataattatttaggtgtaaagatattatttattattttgtgcaattttatgtttacaaagctaaataaatttcattgaatcatcttagcacatgaatg |
8246030 |
T |
|
| Q |
311 |
atgctttgattagtttgtttaaaaacatttttactacaattttttatttaaagaattcgttttgtctatactctaatatatgtctgtg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8246031 |
atgctttgattagtttgtttaaaaacatttttactacaattttttatttaaagaattcgttttgtctatactctaatatatgtgtgtg |
8246118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 70 - 181
Target Start/End: Original strand, 8255297 - 8255408
Alignment:
| Q |
70 |
gaagttacttatttatgcaaccatttgcaacccacttgtcccaacgatttggattatgtgttttgggacagttttcaccctactgaatctgtttacagaa |
169 |
Q |
| |
|
||||||| || |||||||||||||||| ||||||||||| |||||| | |||||||||||||||||| |||||| ||||||||| | ||||||| || |
|
|
| T |
8255297 |
gaagttatttttttatgcaaccatttggaacccacttgtgtcaacgactcggattatgtgttttgggatgcttttcatcctactgaagccgtttacaaaa |
8255396 |
T |
|
| Q |
170 |
aacttgttgccc |
181 |
Q |
| |
|
||||||||||| |
|
|
| T |
8255397 |
tacttgttgccc |
8255408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 44 - 127
Target Start/End: Original strand, 31243551 - 31243634
Alignment:
| Q |
44 |
gaggatgttgtggcactggcacacttgaagttacttatttatgcaaccatttgcaacccacttgtcccaacgatttggattatg |
127 |
Q |
| |
|
|||| ||||||||||| ||| | ||||||||| || |||||||||||||||| ||||||||||| ||||||||| ||| |||| |
|
|
| T |
31243551 |
gagggtgttgtggcacatgcaaaattgaagttatttttttatgcaaccatttggaacccacttgtgccaacgattcggactatg |
31243634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 156
Target Start/End: Original strand, 8262680 - 8262726
Alignment:
| Q |
110 |
ccaacgatttggattatgtgttttgggacagttttcaccctactgaa |
156 |
Q |
| |
|
|||| |||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
8262680 |
ccaatgattcggaatatgtgttttgggacagttttcaccccactgaa |
8262726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University