View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15354_high_9 (Length: 253)
Name: NF15354_high_9
Description: NF15354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15354_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 15379129 - 15379366
Alignment:
| Q |
1 |
atggatatccattaaaatatatgttccgtgtccgtgaaggattttatccgcggatgcggannnnnnngcgatccctatatgagtgatatgatagttacac |
100 |
Q |
| |
|
||||||||||||||||||||||| || |||||| ||| ||||||||||||||| ||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
15379129 |
atggatatccattaaaatatatgctcggtgtccatgacggattttatccgcgggtgcagatttttttgccatccctatatgagtgatatgatagttacac |
15379228 |
T |
 |
| Q |
101 |
ggctaatggaattagggatgcaatgaacaaaccaataaccaggtgaatttgaaaatttagtcccaccaattaaaacagtttcattttcttctacgttcgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
15379229 |
ggctaatggaattagggatgcaatgaacaaaccaataaccaggtgaatttgaaaattctgtcccaccaattaaaacaatttcgttttcttctacgttcgg |
15379328 |
T |
 |
| Q |
201 |
ggtcaaaaccgaactaaaccaaacgaacccgacctttg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15379329 |
ggtcaaaaccgaactaaaccaaacgaacccgacctttg |
15379366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 55
Target Start/End: Complemental strand, 42622410 - 42622357
Alignment:
| Q |
2 |
tggatatccattaaaatatatgttccgtgtccgtgaaggattttatccgcggat |
55 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
42622410 |
tggatatccattaaggtatccgttccgtgtccgtgacggattttatccgcggat |
42622357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 60
Target Start/End: Complemental strand, 28211654 - 28211598
Alignment:
| Q |
4 |
gatatccattaaaatatatgttccgtgtccgtgaaggattttatccgcggatgcgga |
60 |
Q |
| |
|
||||||||||||| ||| || || ||||||||| ||||||||||||||| |||||| |
|
|
| T |
28211654 |
gatatccattaaagtatctgctctgtgtccgtggcggattttatccgcgggtgcgga |
28211598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 55
Target Start/End: Original strand, 47925224 - 47925276
Alignment:
| Q |
3 |
ggatatccattaaaatatatgttccgtgtccgtgaaggattttatccgcggat |
55 |
Q |
| |
|
||||||||||||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
47925224 |
ggatatccattaaggtatccgttccgtgtccgtggcggattttatccgcggat |
47925276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University