View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15354_low_10 (Length: 253)

Name: NF15354_low_10
Description: NF15354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15354_low_10
NF15354_low_10
[»] chr1 (1 HSPs)
chr1 (1-238)||(15379129-15379366)
[»] chr2 (1 HSPs)
chr2 (2-55)||(42622357-42622410)
[»] chr8 (1 HSPs)
chr8 (4-60)||(28211598-28211654)
[»] chr7 (1 HSPs)
chr7 (3-55)||(47925224-47925276)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 15379129 - 15379366
Alignment:
1 atggatatccattaaaatatatgttccgtgtccgtgaaggattttatccgcggatgcggannnnnnngcgatccctatatgagtgatatgatagttacac 100  Q
    ||||||||||||||||||||||| || |||||| ||| ||||||||||||||| ||| ||       || ||||||||||||||||||||||||||||||    
15379129 atggatatccattaaaatatatgctcggtgtccatgacggattttatccgcgggtgcagatttttttgccatccctatatgagtgatatgatagttacac 15379228  T
101 ggctaatggaattagggatgcaatgaacaaaccaataaccaggtgaatttgaaaatttagtcccaccaattaaaacagtttcattttcttctacgttcgg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| |||| |||||||||||||||||    
15379229 ggctaatggaattagggatgcaatgaacaaaccaataaccaggtgaatttgaaaattctgtcccaccaattaaaacaatttcgttttcttctacgttcgg 15379328  T
201 ggtcaaaaccgaactaaaccaaacgaacccgacctttg 238  Q
    ||||||||||||||||||||||||||||||||||||||    
15379329 ggtcaaaaccgaactaaaccaaacgaacccgacctttg 15379366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 55
Target Start/End: Complemental strand, 42622410 - 42622357
Alignment:
2 tggatatccattaaaatatatgttccgtgtccgtgaaggattttatccgcggat 55  Q
    ||||||||||||||  |||  ||||||||||||||| |||||||||||||||||    
42622410 tggatatccattaaggtatccgttccgtgtccgtgacggattttatccgcggat 42622357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 60
Target Start/End: Complemental strand, 28211654 - 28211598
Alignment:
4 gatatccattaaaatatatgttccgtgtccgtgaaggattttatccgcggatgcgga 60  Q
    ||||||||||||| ||| || || |||||||||  ||||||||||||||| ||||||    
28211654 gatatccattaaagtatctgctctgtgtccgtggcggattttatccgcgggtgcgga 28211598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 55
Target Start/End: Original strand, 47925224 - 47925276
Alignment:
3 ggatatccattaaaatatatgttccgtgtccgtgaaggattttatccgcggat 55  Q
    |||||||||||||  |||  ||||||||||||||  |||||||||||||||||    
47925224 ggatatccattaaggtatccgttccgtgtccgtggcggattttatccgcggat 47925276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University