View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15354_low_8 (Length: 301)
Name: NF15354_low_8
Description: NF15354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15354_low_8 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 143 - 301
Target Start/End: Original strand, 34950483 - 34950641
Alignment:
| Q |
143 |
caaattgaatacactattttaaataatcaacaaacaaacaatccataacaaacggagacactctttcacatttttcaatggaaattaaatctataaattg |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34950483 |
caaattgaatacaccattttaaataatcaacaaacaaacaatccataacaaaccgagacactctttcacatttttcaatggaaattaaatctataaattg |
34950582 |
T |
|
| Q |
243 |
agtagcatgaccgttctctcgttaaacaagaacaatttttgatattttctttatcaaaa |
301 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
34950583 |
agtagcatgaccgagctctgattaaacaagaacaattttttatattttctttataaaaa |
34950641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 29 - 60
Target Start/End: Original strand, 34950371 - 34950402
Alignment:
| Q |
29 |
taacttaaatagacaataggtcatataattaa |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34950371 |
taacttaaatagacaataggtcatataattaa |
34950402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University