View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15355_high_6 (Length: 252)
Name: NF15355_high_6
Description: NF15355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15355_high_6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 35161694 - 35161932
Alignment:
| Q |
9 |
agtgagaagaaagtataagatcctctaaaaatatcacaaatgataccactcaaaaacgttgcactgctaactaacttagaccttataatattttagacca |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35161694 |
agtgataagaaagtataagatcctctaaaaatatcacaaatgataccactcaaaaatgttgcactgctaa----cttagaccttataatattttagacca |
35161789 |
T |
|
| Q |
109 |
gtctaaaaatattaagttctaagtttgcaaggatgcacttttttatttggacnnnnnnnnntccacttgccctcatccacataaccgtacctcttgcatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
35161790 |
gtctaaaaatattaagttctaagtttgcaaggatgcacttttttatttggacaaaaaaaaatccacttgccctcatccacatgaccgta-ctcttgcatg |
35161888 |
T |
|
| Q |
209 |
atctcatgaaacaccgtgtcttagaccgatttgcaatataacta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35161889 |
atctcatgaaacaccgtgtcttagaccgatttgcaatataacta |
35161932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University