View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15358_low_10 (Length: 254)
Name: NF15358_low_10
Description: NF15358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15358_low_10 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 254
Target Start/End: Original strand, 18254951 - 18255196
Alignment:
| Q |
9 |
gaagaatatgaaggttgataagaaaataatcnnnnnnnncataaccctccgattctcagaagttcgaatttggattctctagaacaacctgtcgttaact |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18254951 |
gaagaatatgaaggttgataagaaaataatcttttttttcataaccctccgattctcagaagttcgaatttggattctccagaacaacctgtcgttaact |
18255050 |
T |
|
| Q |
109 |
aaaactaatcgacaacttgagtctaacataatgctcggacattctgctagttgtaattgattaatataatattagtaagaagagaattatctgaatttgg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18255051 |
aaaactaatcgacaacttgagtctaacataatgctcggacattctgctaatcgtaattgattaatataatattagtaagaagagaattatctaaatttgg |
18255150 |
T |
|
| Q |
209 |
tttatgattttctttttggttaacagagtaggtgaaaattggccac |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18255151 |
tttatgattttctttttggttaacagagtaggtgaaaattggccac |
18255196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University