View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15358_low_11 (Length: 254)
Name: NF15358_low_11
Description: NF15358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15358_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 20 - 181
Target Start/End: Original strand, 43194933 - 43195094
Alignment:
| Q |
20 |
caggacacaaccaatcgagcatttcacttgttgttggaacaacagggagacaaggagcatgccatggtgttgtgcaggttttgcaatgaagtgtttcggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194933 |
caggacacaaccaatcgagcatttcacttgttgttggaacaacagggagacaaggagcatgccatggtgttgtgcaggttttgcaatgaagtgtttcggt |
43195032 |
T |
 |
| Q |
120 |
ttctgatggtttttgtttgcagaccatgcatacaccgtcagcgtcacaaggaaggtggtgag |
181 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195033 |
ttctgatggtttttgtttgcaaaccatgcatacaccgtcagcgtcacaaggaaggtggtgag |
43195094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University