View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15358_low_9 (Length: 269)
Name: NF15358_low_9
Description: NF15358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15358_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 12268885 - 12269132
Alignment:
| Q |
1 |
gatgttaaagattatgctagtcgtaactcatgctcgtgatttacttcaatcacaagtaattgagccaaatggnnnnnnnnnnnccgcatattacgtgtcg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12268885 |
gatgttaatgattatgctagtcgtaactcatgctcgtgatttacttcaatcacaagtaattgagccaaatggtttttttttt-ccgcatattacgtgtcg |
12268983 |
T |
 |
| Q |
101 |
tgctaggtgtttgaatccattgaaatatcacaaatatataccatcatgttttaagtcactagaatcagtcacaaacctcgtgaattattatttttgctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12268984 |
tgctaggtgtttgaatccattgaaatatcacaaatatataccatcatgttttaagtcactagaatcagtcacaaacctcgagaattattatttttgctac |
12269083 |
T |
 |
| Q |
201 |
gaaaaatgttatgaggaatgtattaattgaataatggtattcatacttt |
249 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12269084 |
gaaaaatgttatgaggattgtattaattgaataatggtattcatacttt |
12269132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University