View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15360_high_23 (Length: 342)
Name: NF15360_high_23
Description: NF15360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15360_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 70 - 323
Target Start/End: Complemental strand, 15246294 - 15246039
Alignment:
| Q |
70 |
atagaacatacttttctttacaatggtcaatggtaaatgttccatttatgtttgctnnnnnnnngttccatttatgtannnnnnnnnagggg--acatgt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||| || ||| |
|
|
| T |
15246294 |
atagaacatacttttctttacaatggtcaatggtacatgttccatttatgtttgctagaaaaaagttccatttatgtatatttttttagggggaacgtgt |
15246195 |
T |
 |
| Q |
168 |
ttatattatttctttaactatggatgtggttatccatgttaaagcatgaacggtcacatttgtttgtcttcatctaaatttgataaaatagttttacaaa |
267 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
15246194 |
ttatattatttctttagttatggatgtggttatccttgttaaagcatgaatggtcacatttgtttgtcttcatctaaattcgataaaagagttttacaaa |
15246095 |
T |
 |
| Q |
268 |
aataaataaattacgacgacgtttacaaatggacattacaacacgaaattttgtaa |
323 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15246094 |
aataaataaattacgacgacgtttataaatggacattacaacacgaaattttgtaa |
15246039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 15246362 - 15246326
Alignment:
| Q |
1 |
ctgaaaaatctttgtgttgcacctcttttacctaacc |
37 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||| |
|
|
| T |
15246362 |
ctgaaaagtccttgtgttgcacctcttttacctaacc |
15246326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University