View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15360_high_35 (Length: 242)
Name: NF15360_high_35
Description: NF15360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15360_high_35 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 2 - 242
Target Start/End: Complemental strand, 10548006 - 10547766
Alignment:
| Q |
2 |
acataggataggaaaagtaatagtcaaacggttttagtcgg-catcaaacttggatgctcaaaatcaatgacagtcttggcccaaacactttatacttta |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10548006 |
acatagaataggaaaagtaatagtcaaactgttttagtcgggcatcaaacttggatgctcaaaatcaatgacagtcttggcccaaacactttatactttg |
10547907 |
T |
|
| Q |
101 |
ttaaacacacatgtaagttccttcnnnnnnnattgacaacatgtaggttcaattcaaagtgtacaataaacgtgttttgttttaaaagaaaagtacaata |
200 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10547906 |
ttaaacacacatgtaggttcttttttttttt-ttgacaacatgtaggttcaattcaaagtgtacaataaacgtgttttgttttaaaagaaaagtacaata |
10547808 |
T |
|
| Q |
201 |
aacggttggcagttacaattgagtacgatgagtagcatattt |
242 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10547807 |
aacggttggcagttacaattcagtacgatgagtagcatattt |
10547766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University