View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15360_high_44 (Length: 211)

Name: NF15360_high_44
Description: NF15360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15360_high_44
NF15360_high_44
[»] chr1 (1 HSPs)
chr1 (21-201)||(10547552-10547737)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 21 - 201
Target Start/End: Original strand, 10547552 - 10547737
Alignment:
21 gaaattgcactcattgccacctccatccactatggaaactgtccataaaacactaaaaaataacacaaatgagacatgaaacttgtttatggtgacaaaa 120  Q
    |||||||||||||||||||| ||||| |||||||||| || |  |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
10547552 gaaattgcactcattgccacttccattcactatggaagctatagataaaacaataaaaaataacacaaatgagacatgaaacttgtttatggtgagaaaa 10547651  T
121 tgcgttgtattactagtcattttgtcggtgagttacact----tataaacaacataattcattgg-aggtgtgtgtatatatatat 201  Q
    |||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||| |||||||||| | |||||||    
10547652 tgcgttgtattactagtcattttgtcggtgagttacacttatatataaacaacataattcattggaaggtgtgtgtgtctatatat 10547737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University