View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15360_low_15 (Length: 420)
Name: NF15360_low_15
Description: NF15360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15360_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 76 - 402
Target Start/End: Original strand, 31904835 - 31905161
Alignment:
| Q |
76 |
tttgctcaattctacgaatcatggcacactcaattcaacaacctaatccaccaactcaaactatcaacctcaacccaaaccgaatcagaagaactcatcc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31904835 |
tttgctcaattctacgaatcatggcacactcaattcaacaacctaatccaccaactcaaactatcaacctcaacccaaaccgactcagaagaactcatcc |
31904934 |
T |
 |
| Q |
176 |
aaaaagttctctctcaccatcaagattactacaatgcaaaatcaatggctgctgaaaaagatccactgcatgttttagcatctccttgggctacaacact |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31904935 |
aaaaagttctctctcaccatcaagattactacaatgcaaaatcaatggctgctgaaaaagatccactgcatgtcttagcatctccttgggctacaacact |
31905034 |
T |
 |
| Q |
276 |
tgaacgttctcttcattggattgctggttggagacccactacagcttttcatctcatctacactgaatcttctcttctttttgagtctcatattattgat |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31905035 |
tgaacgttctcttcattggattgctggttggagacccactacagcttttcatctcatctacactgaatcttctcttctttttgagtctcatattattgat |
31905134 |
T |
 |
| Q |
376 |
attcttcgtgggtttagaactggtgac |
402 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
31905135 |
attcttcgtggatttagaactggtgac |
31905161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University