View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15360_low_30 (Length: 277)
Name: NF15360_low_30
Description: NF15360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15360_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 42241069 - 42241308
Alignment:
| Q |
1 |
tttgtattttataattaatcaaacaagtaacaagaagtccaattgaaagtattcctggacaaacctttgaaagtttatgctgtagtgcatatattgttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42241069 |
tttgtattttataattaatcaaacaagtaacaagaagtccaattgaaagtattccttgacaaacctttgaaagtttatgctgtagtgcatatattgttct |
42241168 |
T |
|
| Q |
101 |
tgactacaccaagaagtaaatctttccggcattttctatctcaacggtgtagaaacttaattttgtcaaggacaaaccttttacaagttttgtctctgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42241169 |
tgactacaccaagaagtaaatctttccggcattttctatctcaacggtgtagaaacttaattttgtcaaggacagaccttttacaagttttgtctctgac |
42241268 |
T |
|
| Q |
201 |
agtctaagacagaagttgttcttaactatgaatctctctg |
240 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42241269 |
aatctaagacagaagttgttcttaactatgaatctctctg |
42241308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University