View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15360_low_40 (Length: 237)
Name: NF15360_low_40
Description: NF15360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15360_low_40 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 102 - 237
Target Start/End: Complemental strand, 4806904 - 4806767
Alignment:
| Q |
102 |
gaatgtcttgaataaacttacttttccttatctctct--taaacttttctcttggagtggttacttgaggatgacaatggctaccttatggaaagggtac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
4806904 |
gaatgtcttgaataaacttacttttccttatctctctcttaaacttttctctcggagtggttacttgaggatgacaatggctatcttatgaaaagggtac |
4806805 |
T |
|
| Q |
200 |
aataatgcacattttggacgtctatatctatgcttttt |
237 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
4806804 |
aataatgcacattttgggcgtctatctctatgcttttt |
4806767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 4806988 - 4806947
Alignment:
| Q |
18 |
ctcttaaaggttcacaaagatataaataaggctcaaattctg |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4806988 |
ctcttaaaggttcacaaagatataaataaggctcaaattctg |
4806947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University