View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15360_low_46 (Length: 211)
Name: NF15360_low_46
Description: NF15360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15360_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 21 - 201
Target Start/End: Original strand, 10547552 - 10547737
Alignment:
| Q |
21 |
gaaattgcactcattgccacctccatccactatggaaactgtccataaaacactaaaaaataacacaaatgagacatgaaacttgtttatggtgacaaaa |
120 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||| || | |||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10547552 |
gaaattgcactcattgccacttccattcactatggaagctatagataaaacaataaaaaataacacaaatgagacatgaaacttgtttatggtgagaaaa |
10547651 |
T |
 |
| Q |
121 |
tgcgttgtattactagtcattttgtcggtgagttacact----tataaacaacataattcattgg-aggtgtgtgtatatatatat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
10547652 |
tgcgttgtattactagtcattttgtcggtgagttacacttatatataaacaacataattcattggaaggtgtgtgtgtctatatat |
10547737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University