View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15361_low_12 (Length: 251)
Name: NF15361_low_12
Description: NF15361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15361_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 210
Target Start/End: Original strand, 25618315 - 25618504
Alignment:
| Q |
20 |
gttgggacttttcttttttatgacatgataataactcatactaagcaatcaaacaaaaagtatatctttgaagttatgaaaacaaaggtttgggtccaag |
119 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25618315 |
gttgggacctttctttttt-tgacatgataataactcatactaagcaatcaaacaaaaagtatatctttgaagttattaaaacaaaggtttgggtccaag |
25618413 |
T |
|
| Q |
120 |
ttgagaaatcaattgaatatcgtggtttacttgtccaacaagtaaacaacttaatgatagtcttttgcacattcaaccacatgattttatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
25618414 |
ttgagaaatcaattgaatatcgtggtttacttgtccaacaagtaaacaacttaatgctagtcttttgcacattcaaccacatgattgtatg |
25618504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University