View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15363_high_21 (Length: 221)
Name: NF15363_high_21
Description: NF15363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15363_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 26661923 - 26661745
Alignment:
| Q |
20 |
aggcttattggttattactagcacatgctgaagttttacgaacaaagaattcagcgtcatggttattagcatattttgggaaaagttagaagaaggtgat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
26661923 |
aggcttattggttattactagcacatgctgaagttttacgaacaaagaattcagcgttatggttattagcatattttggaaaaagttagaagaaggtggt |
26661824 |
T |
|
| Q |
120 |
ttaataaaaacaagttgtctctaacctttttcttcattgattcatgattgggaaaaaacaagaattgccaaacagtggg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26661823 |
ttaataaaaacaagttgtctctaaccttttttttcattgattcatgattgggaaaaaacaagaattgccaaacagtggg |
26661745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 22 - 197
Target Start/End: Complemental strand, 21481840 - 21481663
Alignment:
| Q |
22 |
gcttattggttattactagcacatgctgaagttttacgaacaaagaattcagcgtcatggttattagcatattttgggaaaagttagaagaaggtgattt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
21481840 |
gcttattggttattactagcacatgctgaagttttacgaacaaagaattcagcgtcatggttattagcatattttgggaaaagttagaagaaggtgggtt |
21481741 |
T |
|
| Q |
122 |
aataaaaacaagttgtctctaacctttttctt-cattgattcatgattggg-aaaaaacaagaattgccaaacagtgg |
197 |
Q |
| |
|
|||||||||||||||||||||| |||||| || |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21481740 |
aataaaaacaagttgtctctaaacttttttttgcattgattcatgattgggaaaaaaacaagaattgccaaacagtgg |
21481663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University