View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15363_high_24 (Length: 202)

Name: NF15363_high_24
Description: NF15363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15363_high_24
NF15363_high_24
[»] chr2 (1 HSPs)
chr2 (33-166)||(45690301-45690434)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 45690434 - 45690301
Alignment:
33 gtaatactattaaatggtaagggaaacaaaatgaaagtataaaggaggatgatagttgagagtgcacgcacaccgcaagtgtgtgcctagttattaggca 132  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45690434 gtaatacaattaaatggtaagggaaacaaaatgaaagtataaaggaggatgatagttgagagtgcacgcacaccgcaagtgtgtgcctagttattaggca 45690335  T
133 gatgattatgtatagattttattcaataaataaa 166  Q
    ||||||||||||||||||||||||||||||||||    
45690334 gatgattatgtatagattttattcaataaataaa 45690301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University