View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15363_low_23 (Length: 297)
Name: NF15363_low_23
Description: NF15363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15363_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 137 - 293
Target Start/End: Complemental strand, 26866583 - 26866426
Alignment:
| Q |
137 |
gtttacaaattacataacataataaaaacacactataatttatctaatctaactattatgatatttttaagtttcaaccgtatgcatat-nnnnnnnnnn |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26866583 |
gtttacaaattacataacataataaaaacata-tataatttatctaatctaactattatgatatttttaagtttcaactgtatgcatataaaaaaattca |
26866485 |
T |
|
| Q |
236 |
nnnnntatacgactagggtctg-ttggattgaattatttcagcttatctactaacacaa |
293 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26866484 |
aaaaatatacgactagggtctgtttggattgacttatttcagcttatctactaacacaa |
26866426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 26866629 - 26866583
Alignment:
| Q |
16 |
aacacaatacactaggacaaagacaaaataaattcaaaaaacttaag |
62 |
Q |
| |
|
|||||||||||| | |||||||| | ||||||||||||||||||||| |
|
|
| T |
26866629 |
aacacaatacaccaagacaaagagacaataaattcaaaaaacttaag |
26866583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University