View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15363_low_27 (Length: 277)
Name: NF15363_low_27
Description: NF15363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15363_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 24799765 - 24800012
Alignment:
| Q |
1 |
gtatttgaagtataggagatagatcgaatattgtaaggacaagcaatatcgattggccacatgacattctgaacatgttttctgcttcagaagtacttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24799765 |
gtatttgaagtataggagatagatcgaatattgtaaggacaagcaatatcgattggccacatgacattctgaacatgttttctgcttcagaagtacttaa |
24799864 |
T |
 |
| Q |
101 |
ctatcattttcaannnnnnnnnnnnnnnatgtgtagacaagtttttgaaggaatctagtttagttcgtgtgaaactgtcagaaaatgtgtcttcaatgtg |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24799865 |
ctatcattttca-tttatttatttatttatgtgtagacaagtttttgaaggaatctagtttagttcgtgtgaaactgtcagaaaatgtgtcttcaatgtg |
24799963 |
T |
 |
| Q |
201 |
gtgttagagatgtattcatcaattcaattggctccttagtattattttt |
249 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24799964 |
gtgttagagatgcattcatcaattcaattggctccttaatattattttt |
24800012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University