View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15363_low_28 (Length: 256)
Name: NF15363_low_28
Description: NF15363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15363_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 132 - 238
Target Start/End: Original strand, 14412453 - 14412559
Alignment:
| Q |
132 |
aaaattcaaaatccaattgtaatcgatcttagtagtttagaaatcattggtgttttcaaattaaatgaattcatactcaatattgggttaaattgaaggt |
231 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14412453 |
aaaattcaaaatccaattgtaatctatcttagtagtttagaaatcattggtgttttcaaattaaatgaattcatactcaatattgggttaaattgaaggt |
14412552 |
T |
 |
| Q |
232 |
tcatatg |
238 |
Q |
| |
|
||||||| |
|
|
| T |
14412553 |
tcatatg |
14412559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 14412358 - 14412470
Alignment:
| Q |
1 |
ttgggaaagaattgttacaagaaatttgatcttatatgggaagtgaagatgctagatt------caagatagagaggttacatatatgcttctttaaaat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14412358 |
ttgggaaagaattgttacaagaaatttgatcttatatggaaagtgaagatgctagattcaagaccaagatagagaggttacatatatgcttctttaaaat |
14412457 |
T |
 |
| Q |
95 |
tcaaaatccaatt |
107 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14412458 |
tcaaaatccaatt |
14412470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University