View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15363_low_29 (Length: 255)
Name: NF15363_low_29
Description: NF15363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15363_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 26865942 - 26866166
Alignment:
| Q |
20 |
attccgcggcttagagcaccttcagcggttgccggagcggttaggtcatccctctcagccccggaagccaggtccactcgtatggttccacgccgtttcg |
119 |
Q |
| |
|
|||||||||| | |||||||| ||||||| ||| || ||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26865942 |
attccgcggccttgagcacctccagcggtggccagaacggctaggtcatgcctctcagcctcggaagccaggtccactcgtatggttccacgccgtttcg |
26866041 |
T |
 |
| Q |
120 |
ttaggtgaagggatgattgcgattccagtgatcaaacactgcattcggaaaatgccgaacttgaatgtcctcatcaccatcaccactctctctgcattgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26866042 |
ttaggtgaagggatgattgcgattccagtgatcaaacactgcattcggaaaatgccgaacttgaatgtcctcgtcaccatcaccactctctctgcattgt |
26866141 |
T |
 |
| Q |
220 |
aactcactcttctcattttcttcat |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26866142 |
aactcactcttctcattttcttcat |
26866166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University