View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15363_low_31 (Length: 240)
Name: NF15363_low_31
Description: NF15363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15363_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 169 - 222
Target Start/End: Complemental strand, 10163079 - 10163026
Alignment:
| Q |
169 |
cggtgtgtgtttagcaccaatttattctattttaactcttacatagttgaatct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10163079 |
cggtgtgtgtttagcaccaatttattctattttaactcttacatagttgaatct |
10163026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 47
Target Start/End: Complemental strand, 10163231 - 10163201
Alignment:
| Q |
17 |
aatatttgtcagtggggcgaaaaagatcgtc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10163231 |
aatatttgtcagtggggcgaaaaagatcgtc |
10163201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University