View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15363_low_31 (Length: 240)

Name: NF15363_low_31
Description: NF15363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15363_low_31
NF15363_low_31
[»] chr8 (2 HSPs)
chr8 (169-222)||(10163026-10163079)
chr8 (17-47)||(10163201-10163231)


Alignment Details
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 169 - 222
Target Start/End: Complemental strand, 10163079 - 10163026
Alignment:
169 cggtgtgtgtttagcaccaatttattctattttaactcttacatagttgaatct 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10163079 cggtgtgtgtttagcaccaatttattctattttaactcttacatagttgaatct 10163026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 47
Target Start/End: Complemental strand, 10163231 - 10163201
Alignment:
17 aatatttgtcagtggggcgaaaaagatcgtc 47  Q
    |||||||||||||||||||||||||||||||    
10163231 aatatttgtcagtggggcgaaaaagatcgtc 10163201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University