View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15363_low_38 (Length: 202)
Name: NF15363_low_38
Description: NF15363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15363_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 33 - 166
Target Start/End: Complemental strand, 45690434 - 45690301
Alignment:
| Q |
33 |
gtaatactattaaatggtaagggaaacaaaatgaaagtataaaggaggatgatagttgagagtgcacgcacaccgcaagtgtgtgcctagttattaggca |
132 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45690434 |
gtaatacaattaaatggtaagggaaacaaaatgaaagtataaaggaggatgatagttgagagtgcacgcacaccgcaagtgtgtgcctagttattaggca |
45690335 |
T |
 |
| Q |
133 |
gatgattatgtatagattttattcaataaataaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45690334 |
gatgattatgtatagattttattcaataaataaa |
45690301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University