View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15364_high_7 (Length: 236)

Name: NF15364_high_7
Description: NF15364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15364_high_7
NF15364_high_7
[»] chr1 (2 HSPs)
chr1 (1-217)||(12858850-12859066)
chr1 (1-217)||(12846698-12846914)
[»] chr6 (3 HSPs)
chr6 (107-211)||(15475181-15475285)
chr6 (107-211)||(15168467-15168571)
chr6 (107-155)||(15181605-15181653)
[»] chr2 (1 HSPs)
chr2 (107-211)||(23252904-23253008)
[»] chr8 (2 HSPs)
chr8 (25-215)||(29750874-29751064)
chr8 (46-215)||(30126402-30126571)
[»] scaffold0376 (1 HSPs)
scaffold0376 (62-206)||(9564-9708)


Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 12858850 - 12859066
Alignment:
1 tctgctacgatgaggagtcgaggattgtggctgaatcgcgataagaggattgttggcgcgattcctgggatttgtattggtgacgtgtttttgtatagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||    
12858850 tctgctacgatgaggagtcgaggattgtggctgaatcgcgataagaggattgttggcgcgattcctgggatttgtatcggtgatgtgtttttgtatagga 12858949  T
101 tggagttgtgtgtggttggtttacatggtcaaccacaagctgggattgattatttgccggggagtatgagttcgaatggggaaccgattgctactagtgt 200  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
12858950 tggagttgtgtgttgttggtttacatggtcaaccacaagctgggattgattatttgccggggagtatgagttcgaatggtgaaccgattgctactagtgt 12859049  T
201 gattgtttctggtgggt 217  Q
    |||||||||||||||||    
12859050 gattgtttctggtgggt 12859066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 12846698 - 12846914
Alignment:
1 tctgctacgatgaggagtcgaggattgtggctgaatcgcgataagaggattgttggcgcgattcctgggatttgtattggtgacgtgtttttgtatagga 100  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||    
12846698 tctgctacgatgaggagtcgaggattgtggctgaattgcgataagaggattgttggcgcgattcccgggatttgtattggtgatgtgtttttgtatagga 12846797  T
101 tggagttgtgtgtggttggtttacatggtcaaccacaagctgggattgattatttgccggggagtatgagttcgaatggggaaccgattgctactagtgt 200  Q
    ||||||||||||||||||||||||||||| |||||||||||||||| |||||||| || |||||||||||||| | ||| || |||||||||||||||||    
12846798 tggagttgtgtgtggttggtttacatggtgaaccacaagctgggatcgattattttcctgggagtatgagttcaattggcgatccgattgctactagtgt 12846897  T
201 gattgtttctggtgggt 217  Q
    |||||||||||||||||    
12846898 gattgtttctggtgggt 12846914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 53; Significance: 1e-21; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 107 - 211
Target Start/End: Original strand, 15475181 - 15475285
Alignment:
107 tgtgtgtggttggtttacatggtcaaccacaagctgggattgattatttgccggggagtatgagttcgaatggggaaccgattgctactagtgtgattgt 206  Q
    |||||||| |||| ||||||||||||||||||||||||||||||||||| |  |  ||||||||||| |||||  |||| ||||||||||||||| ||||    
15475181 tgtgtgtgattggcttacatggtcaaccacaagctgggattgattatttacatgctagtatgagttctaatggccaacccattgctactagtgtggttgt 15475280  T
207 ttctg 211  Q
     ||||    
15475281 gtctg 15475285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 107 - 211
Target Start/End: Complemental strand, 15168571 - 15168467
Alignment:
107 tgtgtgtggttggtttacatggtcaaccacaagctgggattgattatttgccggggagtatgagttcgaatggggaaccgattgctactagtgtgattgt 206  Q
    |||||||| |||| ||| ||||||||||||||||||||||||||||||| |  |  ||||||||||| |||||  || | ||||||||||||||| ||||    
15168571 tgtgtgtgattggcttaaatggtcaaccacaagctgggattgattatttacatgctagtatgagttctaatggccaagccattgctactagtgtggttgt 15168472  T
207 ttctg 211  Q
     ||||    
15168471 gtctg 15168467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 15181653 - 15181605
Alignment:
107 tgtgtgtggttggtttacatggtcaaccacaagctgggattgattattt 155  Q
    |||||||| |||| ||| |||||||||||||||||||||||||||||||    
15181653 tgtgtgtgattggcttaaatggtcaaccacaagctgggattgattattt 15181605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 107 - 211
Target Start/End: Original strand, 23252904 - 23253008
Alignment:
107 tgtgtgtggttggtttacatggtcaaccacaagctgggattgattatttgccggggagtatgagttcgaatggggaaccgattgctactagtgtgattgt 206  Q
    |||||||| |||| ||||| ||||||||||||||||||||||||||||| |  |  ||||||||||| |||||  |||| ||||||||||||||| ||||    
23252904 tgtgtgtgattggattacacggtcaaccacaagctgggattgattatttacatgctagtatgagttctaatggccaacccattgctactagtgtggttgt 23253003  T
207 ttctg 211  Q
     ||||    
23253004 gtctg 23253008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 25 - 215
Target Start/End: Complemental strand, 29751064 - 29750874
Alignment:
25 ttgtggctgaatcgcgataagaggattgttggcgcgattcctgggatttgtattggtgacgtgtttttgtataggatggagttgtgtgtggttggtttac 124  Q
    ||||||||| |||||||||||||||| |||||  |||| |||||  ||| | ||||||| |||||||||| ||||||||| ||||||||  ||||||| |    
29751064 ttgtggctgtatcgcgataagaggatagttggaccgatacctggagtttatgttggtgatgtgtttttgtttaggatggaattgtgtgtaattggtttgc 29750965  T
125 atggtcaaccacaagctgggattgattatttgccggggagtatgagttcgaatggggaaccgattgctactagtgtgattgtttctggtgg 215  Q
    ||   ||   ||||||||| ||||||||  ||||    |||| | | || ||||| ||||| |||||||| |||||||||||||| |||||    
29750964 atatgcagatacaagctggcattgattacctgcctaaaagtaggtgctcaaatggtgaaccaattgctaccagtgtgattgtttcgggtgg 29750874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 215
Target Start/End: Original strand, 30126402 - 30126571
Alignment:
46 aggattgttggcgcgattcctgggatttgtattggtgacgtgtttttgtataggatggagttgtgtgtggttggtttacatggtcaaccacaagctggga 145  Q
    ||||| |||||  |||| ||||| |||| | ||||||| |||||| ||| ||||||||| ||||||||   ||||||||||   || || |||||||| |    
30126402 aggatagttggaccgatacctggaatttatgttggtgatgtgtttatgtttaggatggaattgtgtgtaactggtttacatatgcatcctcaagctggta 30126501  T
146 ttgattatttgccggggagtatgagttcgaatggggaaccgattgctactagtgtgattgtttctggtgg 215  Q
    ||||||||||  |    |||||   ||  ||||| ||||| ||||||||||||||||||||||| |||||    
30126502 ttgattatttatcaaatagtatctcttataatggtgaaccaattgctactagtgtgattgtttcaggtgg 30126571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 62 - 206
Target Start/End: Complemental strand, 9708 - 9564
Alignment:
62 ttcctgggatttgtattggtgacgtgtttttgtataggatggagttgtgtgtggttggtttacatggtcaaccacaagctgggattgattatttgccggg 161  Q
    |||||||  ||||||||||||| || ||| | ||||| |  ||  |||||||| |||||||||| ||||||||||||||||||||||||||||  |        
9708 ttcctggtgtttgtattggtgatgtttttctctatagaactgaaatgtgtgtgattggtttacacggtcaaccacaagctgggattgattattcacatcc 9609  T
162 gagtatgagttcgaatggggaaccgattgctactagtgtgattgt 206  Q
     ||||||||| | |||||| ||||  |||||||||||||||||||    
9608 tagtatgagtactaatgggaaacccgttgctactagtgtgattgt 9564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University