View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15364_low_12 (Length: 206)

Name: NF15364_low_12
Description: NF15364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15364_low_12
NF15364_low_12
[»] chr3 (1 HSPs)
chr3 (41-192)||(33068574-33068725)


Alignment Details
Target: chr3 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 41 - 192
Target Start/End: Original strand, 33068574 - 33068725
Alignment:
41 ttaggctaaaaaattatgattccaaagaaggagtatcgtggaagaaaaagtgtacacatgcaacaagatttcaaatagagaggagtgacgaaggaccact 140  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33068574 ttaggctaaaaaattatgattccaaagaaggagtatcgtggaagaaaaagtgtacacatgcaacaagatttcaaatagagaggagtgacgaaggaccact 33068673  T
141 atggggagtgtggaatggattgatttaatttggaattattcagagatgagat 192  Q
    ||||||||||||||||||||||||||||||||||||||||||  ||||||||    
33068674 atggggagtgtggaatggattgatttaatttggaattattcattgatgagat 33068725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University