View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15364_low_5 (Length: 407)
Name: NF15364_low_5
Description: NF15364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15364_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 163 - 291
Target Start/End: Original strand, 47599102 - 47599230
Alignment:
| Q |
163 |
tttgtttacccaatggattttgaggtagagagttatttgatgtaacgcatgcaaggattttgaggcagagctaaacctttgaatgacactgatgggagtc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47599102 |
tttgtttacccaatggattttgaggtagagagttatttgatgtaacgcatgcaaggattttgaggcagagctaaacctttgaatgacactgatgggagtc |
47599201 |
T |
 |
| Q |
263 |
cacggatgttgcttacgctctggttggtg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47599202 |
cacggatgttgcttacgctctggttggtg |
47599230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 17 - 85
Target Start/End: Original strand, 47598952 - 47599020
Alignment:
| Q |
17 |
tagaaaataggtttggtggtgcccaaattgagggagttattttgcggggtttaaaccccacaaattgta |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47598952 |
tagaaaataggtttggtggtgcccaaattgagggagttattttgcggggtttaaaccccacagattgta |
47599020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University