View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15364_low_7 (Length: 257)
Name: NF15364_low_7
Description: NF15364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15364_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 14 - 153
Target Start/End: Original strand, 43328451 - 43328588
Alignment:
| Q |
14 |
acaataagatctgaagtataaattgacgtgggactacttatatgaaggttgttgttgaccatcatattagttccacaatcataaaacaactttgaatata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43328451 |
acaataagatctgaagtataaattgacgtgagactacttatatgaaggtcgttattgactatcatattagttccacaatcacaaaacaactttgaatata |
43328550 |
T |
|
| Q |
114 |
gtatgaacgagtaacattgaaaccatgatatcataatcgc |
153 |
Q |
| |
|
||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
43328551 |
gtatgaatgagtaacgttgaaaccat--tatcataatcgc |
43328588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 196 - 248
Target Start/End: Original strand, 43328631 - 43328683
Alignment:
| Q |
196 |
tgatctccaaattcacgatgtgacacaaaatgttgttgattgcctttgctact |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43328631 |
tgatctccaaattcacaatgtgacacaaaatgttgttgattgcctttggtact |
43328683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University