View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15365_high_21 (Length: 332)
Name: NF15365_high_21
Description: NF15365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15365_high_21 |
 | |
|
| [»] scaffold0114 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0114 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: scaffold0114
Description:
Target: scaffold0114; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 16 - 327
Target Start/End: Complemental strand, 5986 - 5675
Alignment:
| Q |
16 |
aggtacgtgcggtctctaaacatatgtccattcttcatgatggggataatgtcatctcggacccaattgagatagaggaccatgttgtgtcatattttca |
115 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5986 |
aggtacgtgcggtttctaaacatatgtccattcttcatgatagggataatgtcatctcggacccaattgagatagaggagcatgttgtgtcatattttca |
5887 |
T |
|
| Q |
116 |
gtctatttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagaatgatttattatgttgc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
5886 |
gtctatttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagactgatttattatgtcgt |
5787 |
T |
|
| Q |
216 |
ttacctgtgatgtctgaaataaagtctgcggtttttcatcttaatgatgatagtgcgccgggtccagacgggtttggtgggcatttttacaagacgtttt |
315 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||| |||| |
|
|
| T |
5786 |
ttacctatgatgtctgaaataaagtctgcggtttttgatcttaatggtgatagtgcgccgggtcctgacgggtttggtgggcatttttactagacatttt |
5687 |
T |
|
| Q |
316 |
gggacattattt |
327 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5686 |
gggacattattt |
5675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University