View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15367_low_12 (Length: 248)
Name: NF15367_low_12
Description: NF15367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15367_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 426804 - 426595
Alignment:
| Q |
17 |
caaaggcttaaattaaattcgaggagtttgaattgtaatcttatgaacatggataaagtcctactcatattctaagattcttcacctttacattctgttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
426804 |
caaaggcttaaattaaattcgaggagtttgaattgtaatcttatgaacatggataaagtcctactcatattctaagattcttcacctttacattctgttt |
426705 |
T |
|
| Q |
117 |
tttaatcttaatttgaaaactttggtgccctttttacattgagcatgtcaaatttataaagttgatagatttgatctatgaagcatggatatggacacgg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
426704 |
tttaatcttaatttgaaaactttggtgccctttttacattgagcatgtcaaatttataaagttgatagatttgatctatgaagcatggatacagacacgg |
426605 |
T |
|
| Q |
217 |
ataccggaca |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
426604 |
ataccggaca |
426595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 226
Target Start/End: Complemental strand, 6326412 - 6326378
Alignment:
| Q |
192 |
ctatgaagcatggatatggacacggataccggaca |
226 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
6326412 |
ctatgaagcatggataaggacacggataccggaca |
6326378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 226
Target Start/End: Complemental strand, 46084083 - 46084047
Alignment:
| Q |
190 |
atctatgaagcatggatatggacacggataccggaca |
226 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
46084083 |
atctatgaagcatggatacggacacggacaccggaca |
46084047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University