View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15367_low_7 (Length: 314)
Name: NF15367_low_7
Description: NF15367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15367_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 29791841 - 29791980
Alignment:
| Q |
19 |
atatgatatgagcacggggtgattctctagtaaggcattgtgaagtttttcccattcaccccttctttgcacattggaccactcaccttcatttcttaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||| |
|
|
| T |
29791841 |
atatgatatgagcacggggtgattctctagtaaggcattttgaagtttttcccattcaccccttatttgcacattcgaccactcaccttcatctcttaca |
29791940 |
T |
 |
| Q |
119 |
tacttctcttggtcatctagtatggagaggttggtctatg |
158 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29791941 |
tacttctcttggttatctagtatggagaggttggtctatg |
29791980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University