View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15368_high_11 (Length: 256)
Name: NF15368_high_11
Description: NF15368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15368_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 1383025 - 1382784
Alignment:
| Q |
18 |
attgtaagtgttgttacaatcttgtaattttattatttcaatttaccactgcttctaannnnnnn-atttc---------aaggttgggaggcctgacct |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
1383025 |
attgtaagggttgttacaatcttgtaattttattatttcaatttatcactgcttctaattttttttatttcttacccttcaaggttgggaggcctgacct |
1382926 |
T |
 |
| Q |
108 |
aatcttatatcacctaaaacacacccaaggattttctcttgctcttgctagtttaaagtacctggtatgatttgattgataccgtttttacattattaca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1382925 |
aatcttatatcacctaaaacacacccaaggattttctcttgctcttgctagtttaaagtacctggtatgatttgattgataccgtttttacattattaca |
1382826 |
T |
 |
| Q |
208 |
aaatcaaatatttcatatatcttgtctttactttctctgctc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1382825 |
aaatcaaatatttcatatatcttgtctttactttcactgctc |
1382784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 148
Target Start/End: Original strand, 11924708 - 11924740
Alignment:
| Q |
116 |
atcacctaaaacacacccaaggattttctcttg |
148 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
11924708 |
atcacctaaaacacaccgaaggattttctcttg |
11924740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University