View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15368_high_14 (Length: 241)
Name: NF15368_high_14
Description: NF15368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15368_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 34880343 - 34880114
Alignment:
| Q |
1 |
atgatgtgatcatgtgacagtgttatcaattatgaggtcaatgtaacnnnnnnnnn---gtaggctgtggatatttctccaaatcctggacgctcggatc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880343 |
atgatgtgatcatgtgacagtgttatcaattctgaggtcaatgtaacttttttttttttgtaggctgtggatatttctccaaatcctggacgctcggatc |
34880244 |
T |
 |
| Q |
98 |
ctatgtacattgtgtactctaggaagctggctaccgcataagagaaacatgaaccgataattcgtagctgtgcctttacctatcagcagttactgtgatg |
197 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34880243 |
ccatgtacattgtgtactctaggaagctggctaccgcataagagaaacatgaaccgataattcgtagctgtgcctttacctatcagcagttattgtgatg |
34880144 |
T |
 |
| Q |
198 |
gggaattcgctcatattgtatgccaatgat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34880143 |
gggaattcgctcatattgtatgccaatgat |
34880114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University