View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15368_low_15 (Length: 319)
Name: NF15368_low_15
Description: NF15368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15368_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 13 - 302
Target Start/End: Complemental strand, 30382472 - 30382185
Alignment:
| Q |
13 |
aatatgtggagttttgagatgcaacatttatagtattaatttgttgtaagtcttaaaaaattcactcctatcaaagttttaatttgatgtgcattgtgtg |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30382472 |
aatacgtggagttttgagatgcaacatttatagtattaatttgttgtaagtcttaaaaaattcactcctatcaaagttttaatttgatgtgcattgtgtg |
30382373 |
T |
 |
| Q |
113 |
taaattttgcttatctctaggtaccgatcattcctattattttgctgacatgtttaacaacattgattcaccgattaatattttgtctttgattgcatca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30382372 |
taaattttgcttatctctaggtaccgatcattcctattattttgctgacatgtttaacaacattgattcaccgattaata--ttgtctttgattgcatca |
30382275 |
T |
 |
| Q |
213 |
cggtaagttagtaggatcagcaattcatccaaatcataaaataagtccaagctcagtgatttcatttaagacaaaatggtgttaggcttg |
302 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30382274 |
cggtaagttagtagtatcagcaattcatccaaatcataaaataagtccaagctcagtgatttcatttaagacaaaatggtgttaggcttg |
30382185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University