View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15368_low_22 (Length: 249)
Name: NF15368_low_22
Description: NF15368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15368_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 66 - 232
Target Start/End: Complemental strand, 8496833 - 8496667
Alignment:
| Q |
66 |
agtaaaaacaatatggtacgattctcaaccctaaccctagttgttgtttttctttcctgtgttgcatcctcctatgcagctaatgttgcagatccacaaa |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8496833 |
agtaaaaacaatatggtacgattctcaaccctaaccctagttattgtttttctttcctgtgttgcatcctcctatgcagctaatgttgcagatccacaaa |
8496734 |
T |
 |
| Q |
166 |
ccatttgcaagaaagccaaagatccatctttttgcttgaattttctgaaatcaaagcccggtggtgt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8496733 |
ccatttgcaagaaagccaaagatccatctttttgcttgaattttctgaaatcaaagcccggtggtgt |
8496667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 47
Target Start/End: Complemental strand, 8496895 - 8496861
Alignment:
| Q |
13 |
agcaaaggaaatcacaacacacaatagaagaatta |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8496895 |
agcaaaggaaatcacaacacacaatagaagaatta |
8496861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 97 - 232
Target Start/End: Original strand, 8503585 - 8503720
Alignment:
| Q |
97 |
taaccctagttgttgtttttctttcctgtgttgcatcctcctatgcagctaatgttgcagatccacaaaccatttgcaagaaagccaaagatccatcttt |
196 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||| | |||||||| ||| ||| | ||||||||| |||||||||| || ||||| |
|
|
| T |
8503585 |
taaccctagttgttgtgtttcttttttgtgttgcatcctcctatgccgttaatgttgttgatgtgcaagctatttgcaaggaagccaaagacccttcttt |
8503684 |
T |
 |
| Q |
197 |
ttgcttgaattttctgaaatcaaagcccggtggtgt |
232 |
Q |
| |
|
||| || | | |||| ||||||||||| |||||||| |
|
|
| T |
8503685 |
ttgtttaactcttctcaaatcaaagccaggtggtgt |
8503720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 101 - 150
Target Start/End: Original strand, 8501703 - 8501752
Alignment:
| Q |
101 |
cctagttgttgtttttctttcctgtgttgcatcctcctatgcagctaatg |
150 |
Q |
| |
|
|||||||||||| ||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
8501703 |
cctagttgttgtgtttcttttttgtgtcgcatcgtcctatgcagctaatg |
8501752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University