View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1536_high_14 (Length: 237)
Name: NF1536_high_14
Description: NF1536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1536_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 36952403 - 36952196
Alignment:
| Q |
13 |
catagggcaataatctttccagtagaagtctacagaacagtgtggaggagtcaattgtgaaccctccttaggaaagtacatccttattctagctctttct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36952403 |
catagggcaataatctttccagtagaagtctacagaacagtgtggaggagtcaattgtgaaccctccttaggaaagtacatccttattctagctctttct |
36952304 |
T |
|
| Q |
113 |
ccaaaatcagacgaccgaacttcacgtgcaggaactggtgtaatttttcctacagtgtacctgagaattgagcnnnnnnnnttcaaatcaaagcttcata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36952303 |
ccaaaatcagacgaccgaacttcacgtgcaggaactggtgtaatttttcctacagtgtacctgagaattgagcaaaaaaaattcaaatcaaagcttcata |
36952204 |
T |
|
| Q |
213 |
taaaacat |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
36952203 |
taaaacat |
36952196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University