View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1536_low_19 (Length: 216)
Name: NF1536_low_19
Description: NF1536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1536_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 11982861 - 11983045
Alignment:
| Q |
15 |
atgaaattgtttggaattaataagatcagacttagtgaagataagatcattgccacccttttcctcttctttagtgcagaagagttgtatagaaggaatt |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11982861 |
atgaaattgtttggaatttataagatcagacttagtgaagataagatcattgccacccttttcctcttctttagtgcagaagagttgtatagaaggaatt |
11982960 |
T |
|
| Q |
115 |
ttttggccctagaaaactcatcacagtcatcgcaaaaattggcaacgtcgaggacatttgactccttattgaatgaagcaatctg |
199 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
11982961 |
ttttggccctagaaaactcatcacggtcatcgcaaaaattggcaacgtcgacgacatttgacacctcattgaatgaagcaatctg |
11983045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University