View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15371_high_9 (Length: 216)

Name: NF15371_high_9
Description: NF15371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15371_high_9
NF15371_high_9
[»] chr5 (1 HSPs)
chr5 (20-216)||(5039038-5039234)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 5039234 - 5039038
Alignment:
20 gtttgtttacattaataatgtaacaatgttcaaaatgacacttctgttacaacttttgcgggcagaaaatgattaattatcaatgcaatgtgactctttg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
5039234 gtttgtttacattaataatgtaacaatgttcaaaatgacacttctgttacaacttttgcgggcagaaaatgattaatcatcaatgcaatgtgactctttg 5039135  T
120 actctactgtgtgagtatcactgttatgctatattgtgtggtcaaatggagattggcactgataagtataaccagtagatgattgatatgaacggca 216  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5039134 actctactgtgtgagtatcactgttatgctatattgtgtgttcaaatggagattggcactgataagtataaccagtagatgattgatatgaacggca 5039038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University